AGCCTATTTTGCGCAAAGCCTATTTTGCGCAAAGCCTATTTTGCGCAA
The Living DNA test is $40 Cdn off, $159 discounted from $199.
Family Tree DNA have discounts on many of their tests, Family Finder is $59 US, down from $79 US.
AncestryDNA are advertising $30 Cdn off their test through 25 April.
MyHeritage has $20 US off, now $79 UK.
Nothing yet from 23andMe.
AGCCTATTTTGCGCAAAGCCTATTTTGCGCAAAGCCTATTTTGCGCAA
Don't dare dawdle!
Discounts disappear!
No comments:
Post a Comment