At last.
Tower Hamlets Cemetery, 33 acres, mainly served London's East End. Many were pauper burials lacking a monument. One of London's Magnificent Seven cemeteries, Tower Hamlets cemetery records have been available at the London Metropolitan Archives for years but only a limited range of years had been transcribed. Now they're at Ancestry.
Ancestry's Tower Hamlets collection brings together the daybooks and registers of burials, and the register of private graves. There are 764,378 indexed entries which includes the same person in different documents.
A typical entry has name, abode, when buried, age and by whom the ceremony was performed.
While free is good in the long run you get what you pay for. Ancestry's arrangement with the LMA, which has brought many London records online, shows the power of money again in bringing indexed records linked to images of the original burial records online.
The site. closed to burials since 1966, is now a cemetery park and nature reserve with multiple uses. See a YouTube video on the present (2016) situation at https://www.youtube.com/watch?v=ZUd_IPqSt24.
Deceased Online includes four of the Magnificent Seven in it's inventory of 65 London Cemeteries, Brompton, Highgate, Kensal Green, and Nunhead. Transcripts for Abney Park are free with registration online at www.devsys.co.uk/ap/. That leaves West Norwood without comprehensive online access to burial records.
To inspire searching London cemetery records Coldplay has some appropriate music.
30 April 2017
Ancestry adds London, England, City of London and Tower Hamlets Cemetery Registers, 1841-1966
British Newspaper Archive additions for April
The British Newspaper Archive now has 19,300,046 pages (18,909,558 pages last month) from 756 (750) titles online.
Major additions are highlighted.
| TITLE | DATE RANGE |
|---|---|
| John Bull | 1822-1825, 1834-1842, 1845-1857, 1862-1892 |
| Boston Guardian | 1929, 1937 |
| Northern Whig | 1872-1873, 1876-1882, 1889 |
| Nottingham Journal | 1879, 1887, 1890-1891, 1898-1902, 1905-1909, 1913-1925, 1931-1950 |
| Galway Vindicator, and Connaught Advertiser | 1873-1899 |
| Ballymena Weekly Telegraph | 1904, 1906-1916, 1921-1929, 1931-1957 |
| Belfast News-Letter | 1927 |
| Yarmouth Independent | 1862-1863, 1868, 1871, 1876-1877, 1879, 1882, 1885, 1889-1893, 1901, 1903, 1906-1910, 1913-1914, 1916-1927, 1932-1937 |
| Todmorden & District News | 1871-1895, 1898-1932 |
| Rugby Advertiser | 1853-1854, 1856-1871, 1874-1889, 1915-1931, 1934-1957 |
| Southern Echo | 1901-1908 |
| West London Observer | 1894-1915 |
| Motherwell Times | 1955-1957 |
| The People | 1914-1917 |
| Shields Daily News | 1898 |
| Western Daily Mercury | 1912 |
| North London News | 1871-1892, 1894-1895 |
| John o' Groat Journal | 1887-1888 |
| East Anglian Daily Times | 1890-1893, 1895, 1901, 1903-1904, 1906, 1908-1909 |
| Bradford Observer | 1882 |
| Surrey Comet | 1881-1887, 1890-1891, 1893-1896, 1898, 1900-1910 |
| Greenock Telegraph and Clyde Shipping Gazette | 1880-1881, 1894-1898 |
| Shipping and Mercantile Gazette | 1870, 1873, 1875-1879 |
| Gloucester Citizen | 1958 |
TheGenealogist releases over 100,000 Parish Records and thousands of voter records
Also added are records covering 35 different registers of people who were entitled to vote in Wakefield, West Yorkshire and other constituencies situated in Hampshire, Gloucestershire, Somerset and New Westminster in Canada. These have been added to the Poll and Electoral Roll collection covering millions of records.
To search these and many other records on TheGenealogist, go to: www.thegenealogist.co.uk
29 April 2017
Findmypast adds Kent transcript parish records
Look for help in this week's transcript additions to Findmypast.
- over 18,000 baptisms
- 3,000 banns
- 312,000 marriages
- 18,000 burials
Also in North West Kent there are transcript additions of 23,000 baptisms, making more than 50,000 baptismal records for Bexley, Chelsfield, Crayford, North Cray, Westerham, Stone, Darenth, Longfield, Meopham, Southfleet and Greenwich; and an addition of 15,000 burials at St Mary in Bexley, St Martin of Tours in Chelsfield, St Margaret in Lee and St John the Baptist in Meopham.
28 April 2017
BCGS Conference: 9-11 June 2017
The theme: Celebrating Our Canadian Ancestors.
Speakers include Dave Obee, Claire Smith-Burns, Mary Read, Xenia Stanford and Susanne Sulzberger.
Central, accessible location: Best Western Plus Coquitlam Inn Convention Centre, 319 North Road, Coquitlam, BC V3K 3V8
Tickets available on-line or by e-mail, phone or mail.
See the BC Genealogical Society website for details. http://www.bcgs.ca/?page_id=2511
Thanks to Diane M. Rogers for the information.
Prepare for OGS Conference add-ons
If you're coming from away don't stop with the conference.
Important for any Canadian researcher, genealogical or historical, is Library and Archives Canada.
A flood of researchers is expected at LAC. If you plan on being part of it preparation is essential.
Some hints.
1. You will need a reader card which can be ordered using an online form, see the procedure at http://www.bac-lac.gc.ca/eng/services-public/Pages/Registration-Intro.aspx/.
2. Get advice before your trip from an LAC expert. see http://www.bac-lac.gc.ca/eng/services-public/ask-question/Pages/ways-ask-question.aspx/.
3. Material not available on open shelves needs to be brought to the building from another location. That can take a day or even a week so ordering in advance is essential.
4. Public transit is a good option for getting to and from the LAC building at 395 Wellington Street which is at the north end of Bay Street from the Algonquin College conference site. Take advantage of the travel planner at http://www.octranspo.com/travelplanner/travelplanner or on Google maps.
5. There is no restaurant or cafe in the LAC building. On the ground floor there are food and drink vending machines near the lockers and a few places to sit.
6. Check out the amazing collection of city directories on open shelves on the 2nd floor, through the doors to the left as you exit the elevators. Also on the 2nd floor is the reader registration area and consultation for non-genealogical queries..
7. On the 3rd floor, to the right off the elevators, is the genealogy consultation area; to the left is the document consultation area.
Finally, don't overlook Using Ancestry Day being held at the Algonquin College site on the Monday after the conference with well known Ancestry expert speaker Crista Cowan and Ancestry’s DNA product manager Anna Swayne.
BTW. If you've not made plans yet, and don't have family or a friend to stay with, I'm told accommodation is still available at the residence at the Algonquin College conference site.
27 April 2017
Many Findmypast records free this weekend
Ancestry's World Archives Project Update
Ancestry has published an update on its volunteer-powered indexing World Archives Project covering the last year.
In 2016 405,134 image sets were indexed for a total of 15,234,403 records
So far in 2017 80,180 image sets have been indexed for a total of 3,882,024 records.
Find a list of completed projects at http://www.ancestry.com/wiki/index.php?title=World_Archives_Project,_Live_Projects
Selected active indexing projects, all considered to be of average difficulty and of likely interest to readers of this blog, are:
Bedfordshire, England, Workhouse and Poor Law Records
Belfast, Northern Ireland, The Belfast Newsletter (Birth, Marriage and Death Notices), 1738-1925 (Part 3)
Ontario, Canada, The Ottawa Journal (Birth, Marriage and Death Notices), 1885-1980
UK, Absent Voters Lists (Part 1).
There's also a UK, Historical Photographs project assessed as easy.
Timely death statistics
The provisional number of deaths registered in England and Wales in March 2017 was 48,615; this represents an increase of 889 deaths in comparison with the previous month and a decrease of 25 deaths in comparison with the same month in 2016.Weekly statistics are issued. This week it's
The provisional number of deaths registered in England and Wales in the week ending 14 April 2017 (week 15) was 8,493; this represents a decrease of 1,446 deaths registered in comparison with the previous week (week 14).Timely issue of death statistics goes back to bills of mortality, weekly mortality statistics in London, designed to monitor burials from 1592 to 1595 and then continuously from 1603.
The average number of deaths for the corresponding week over the previous 5 years was 10,624.The decrease in the deaths registered in the week ending 14 April 2017 is likely to be due to the closure of register offices over the Easter period. This pattern is similar to previous years.
26 April 2017
Advance Notice: Secret Lives – Hidden Voices of our Ancestors
There's a major conference planned for late summer 2018 in England which you may want to plan on attending..
Four major genealogical organisations, the Association of Genealogists and Researchers in Archives (AGRA), The Guild of One Name Studies, the Halsted Trust and the Society of Genealogists are cooperating to host a major family history conference to be held from Friday 31st August to Sunday 2nd September 2018 in Hinckley, Leicestershire.
The theme is Secret Lives – Hidden Voices of our Ancestors. Some potential topics are:
Bigamy, Divorce, Marriage breakdown from 18th-20th centuries; LGBTQIA Lives, social history, records and current research; Criminal under class; Bagnios and Bawdy Houses. Prostitution in18th Century London; Fallen Women -Victorian Prostitution and Reform; Victorian Detectives, Police and Crime; Transportation; Social deprivation in London and other urban areas; Social deprivation and life in rural areas; Researching Women ancestors; Ecclesiastical or Bawdy Courts cases; Litigation and civil and equity court records case studies; Migrant communities – Jewish Manchester, Irish Liverpool
Workhouses and other institutions inmates; School and institutions for poor children; A poor person’s death- Funeral Clubs and Friendly Societies;There a call out for presentation proposals at secretlives.org.uk/
Historical Society of Ottawa: April meeting
Friday 28 April 2017: 1 pm
Routhier Community Centre
172 Guigues Street
Thomas Ahearn - The Electrification of Ottawa, presented by Kelly Ray
Abstract: Thomas Ahearn, born in Lebreton Flats to Irish immigrant parents, was an early adapter of new technology. He brought innovation to Ottawa by introducing electricity to the city. He provided lighting, powered his streetcars, and developed a number of electrical devices such as irons, stoves and heaters. He was the first person to prepare a meal on an electric stove, among other things. Hear about his technological and political achievements that helped shape the city of Ottawa and see documents and artifacts from this Canadian inventor and businessman.
Profile: Kelly Ray works in public affairs for the Canada Science and Technology Museum. Holding degrees in anthropology and public relations, it is quite fitting that as a great, great grand niece of Thomas Ahearn, she makes a career of sharing stories of innovation and Canadian technology. She has worked for over a decade in the cultural and tourism sectors at the Calgary Zoo as well as multiple museums here in Ottawa.
25 April 2017
A Footnote in Canadian Military History

Little died 10 days after the start of the First World War, the first man serving with the Canadian Expeditionary Force to die. While the circumstances were not militarily glorious, he died of a heart attack in the train heading east having left Edmonton just a few hours earlier, he gets the same dignified recognition as all other casualties.
Both his father and grandfather had seen service in Canada with the British Army.
Little was one of the many British immigrants who joined up early with the CEF. Born in Stroud, on the edge of the scenic Cotswolds, his grave site has a certain Prairie charm.
24 April 2017
Alberta Genealogical Society Conference: Day 2
With three presentations to give my perspective on the conference was limited. I enjoyed giving all the presentations on London Burials, British WW2 Child Evacuees to Canada and British Newspapers.
I did manage to attend the opening plenary by Kyle Betit on his experience with WDYTYA, the US TV program. ProGenealogists, the part of Ancestry in which he is involved, spends an average of 600 hours researching each episode, starting with building a family tree back 4 generations. These days the celebrities (or their agents) come of WDYTYA to be involved whereas for the first few series they had to be solicited.
Along the way Kyle mentioned that AncestryDNA now has 4 million tests completed, up from 3 million in January.
Thank's to the Alberta Genealogical Society for allowing me to be part of their event.
BIFHSGO Conference 2017 Speakers
There was a deliberate decision made this year not to program any of the OGS conference speakers which meant declining some proposals that would certainly be accepted otherwise.
Keynote speaker Celia Heritage has never spoken here before. Celia is a regular at WDYTYA? Live. Paul Milner got rave reviews last time he spoke to BIFHSGO so was invited back. Rounding out the out-of-town contingent is James F. S. Thomson, one of my personal favourites.
BIFHSGO is fortunate to have local people to profile, all of whom have spoken before, adding to the diversity and strength of the program.
Find out more about BIFHSGO Conference 2017 at https://bifhsgo.ca/aem.php?eid=8
23 April 2017
Ancestry Updates Obituary Collections
Canada, Obituary Collection, 1898-2015, 1,266,544 records
UK and Ireland, Obituary Index, 2004-2017, 1,077,844 records
are the most recent updates to the Ancestry obituary collections.
The US and Australia & New Zealand collections are also updated.
Alberta Genealogical Society Conference: Day 1
Congratulations to the organizers of the Alberta Genealogical Society conference being held in Edmonton this weekend, billled as "Ye Olde Genealogy Faire". The venue was expertly decorated on the theme by members of the Red Deer Branch.
Some of the presenters, including David and Celia Tyler from Raymond, Alberta, were dressed for the occasion.
The attendence was a record for the society, 300 counting presenters and exhibitors.
Winner of the Ancestry door prize for a 0ne year full Ancestry subscription was Solveig Anderson.
Aside for the organizers the hardest working person at the event was Diahan Southard who gave three presentations and the evening banquet talk.
St George`s Day Feast
What more appropriate than a serving of fish and chips
https://telescoper.wordpress.com/2010/08/26/150-years-of-fish-and-chips/
22 April 2017
Findmypast updates Easter Rising & Ireland Under Martial Law 1916-1921
With this addition of over 76,000 records this database now totals 204,630 records. Findmypast describe them as "prisoner lists, case files, search reports, court-martials and much more."
Dig slightly further and read that
"created in partnership with The National Archives in London and contains 91 pieces from their WO35 series, War Office: Army of Ireland: Administration and Easter Rising Records. The pieces from the collection (from WO 35 and HO 144) include court-martial registers, reports of the events of Easter Rising week, search and raid reports, files of civilians tried by court-martial, and internment camp and prison registers."
"What We Leave Behind." War Memory, Vimy Ridge and the British Commonwealth
The Ottawa Historical Association,
in collaboration with
Library and Archives Canada, presents a lecture:
"What We Leave Behind."
War Memory, Vimy Ridge and the British Commonwealth
by Robert Engen, Assistant Professor, Royal Military College of Canada,
and Andrew Horrall, Senior Archivist, Library and Archives Canada.
Tuesday, May 9, 2017, at 7:00 p.m.
395 Wellington Street, 2nd Floor
Ottawa, Ontario
Library and Archives Canada
Register at www.bac-lac.gc.ca/eng/about-us/events/Pages/Event%20Registration.aspx?eventid=22
Presentation in English
This free lecture is open to the public.
21 April 2017
Newspapers.com adds Guardian and Observer
Gordon Flowerdew, home child?
This article about Eric Flowerdew and his wife, successful poultry farmers in BC, caught my attention. He came from a large Norfolk farming family, and served with British Forces during the First World War arriving in Canada shortly thereafter.
The article, from April 1927, ends with the advice that "Canadian farmers want real workers. For that class there is every chance. Others had better stay away."
A name like Flowerdew is one we all wish we had to research. Google popped up one Gordon Flowerdew, Eric's older brother, who was posthumously awarded the Victoria Cross serving with the Canadian Expeditionary Force.
His biography in the DCB ends "Flowerdew is of some interest both for the way he lived and for the manner of his death. Like many other young Britons, he had come to Canada at the turn of the century to seek his fortune without giving up his British roots and had volunteered to fight for the empire in 1914. Tragically, but also typically, he died carrying on a military tradition centuries-old but set in a different, industrialized style of warfare."
Gordon Flowerdale arrived in Canada in 1903, one of the pre-war immigrants from Britain I'll be speaking about at the Alberta Genealogical Society conference this week end. He appears in the Home Child database on the LAC website but given his age on immigration, 18, and background he doesn't fit the profile of the typical home child.
20 April 2017
Delightful DNA Day Deep Discounts
AGCCTATTTTGCGCAAAGCCTATTTTGCGCAAAGCCTATTTTGCGCAA
The Living DNA test is $40 Cdn off, $159 discounted from $199.
Family Tree DNA have discounts on many of their tests, Family Finder is $59 US, down from $79 US.
AncestryDNA are advertising $30 Cdn off their test through 25 April.
MyHeritage has $20 US off, now $79 UK.
Nothing yet from 23andMe.
AGCCTATTTTGCGCAAAGCCTATTTTGCGCAAAGCCTATTTTGCGCAA
Don't dare dawdle!
Discounts disappear!
British Newspaper Archive adds Yarmouth Independent
One of my presentations to this weekend's Alberta Genealogical Society conference is on British Newspapers, a resource I enjoy using and speaking about.
Visiting the British Newspaper Archive site to update one of the slides I found the latest addition is an extended selection of issues, over 2,000, of the Yarmouth Independent, published in my home-town of Great Yarmouth. That's over 22,000 pages for the years 1862-1863, 1868, 1871, 1876-1877, 1879, 1882, 1885, 1889-1893, 1901, 1903, 1906-1910, 1913-1914, 1916-1917, 1919-1927, 1932-1937. No longer can I complain that my part of England is ignored by the BNA.
I'd planned on suggesting to AGS conference attendees that everyone with British ancestry try a one month BNA subscription. It's a bargain, half the cheap day return fare on Southwest Trains into London and the British Library when I stay with family.
Check out the places in your British and Irish family history. Chances are there's information on an ancestor in the BNA that will be new to you.
Ancestry adds UK, Military Indexes, 1920-1971
Ancestry describes these lists as comprising "the names and service numbers of those who were discharged from the armed forces after 1920 and born before 1901. Details given for over 300,000 (371,716) individuals found within this collection may include (where available):
Initial and SurnameIt's most likely to be useful for the date of birth information.
Date of Birth
Their Service
Service Number
Ministry of Defence Reference Number."
The source, "public sector information licensed under the Open Government Licence v3.0," leads to a collections of datasets hosted by the UK National Archives. I found little of genealogical interest, many are merely catalogue entries for unpublished datasets.
Ottawa Branch OGS April Meeting
That's unless instead you plan on attending the Scottish Genealogy Group which meets at 10:00 am.
"The digitization of collections held by Library and Archives Canada (LAC) is inviting academics, individuals, genealogists and community-based groups to engage in digitizing LAC collections. The newly-established DigiLab at 395 Wellington Street in Ottawa is a hands-on facility for users to digitize and contextualize LAC collections of value to their study, work and communities. All of the material digitized through the DigiLab will be made available online for general public access.As one of the few people who have used DigiLab, which only opened this month, I can attest to the potential. The image captures the three types of scanners available.
The goal of the DigiLab is to facilitate digitization projects that make available a range of materials from LAC’s vast collections that may not otherwise be digitized. By working with and meeting the needs of a variety of users and communities, LAC will expand its digital content and make this documentary heritage available to everyone."
The computer interest group will meet following the main event.
It's all happening at the City of Ottawa Archives, 100 Tallwood Drive
19 April 2017
YouTube: Sources for Genealogical Research in the National Archives, Ireland
The Genealogical Society of Ireland was given a lecture on 11 April 2017 by Tom Quinlan, Keeper at the (Irish) National Archives on the organization holdings of genealogical interest.
It covers the main resources, available both online and those for which you need to visit the physical archive. You'll get a good understanding of why things are as they are, and right at the end a couple of minutes on plans for further records to be made available online.
OGS Kingston Branches April Meeting
The Kingston Branch of the Ontario Genealogical Society will meet at the Kingston Seniors Centre, 56 Francis Street in Kingston on Saturday, April 22 at 10 a.m. Gary Foster, president of Campbell Monuments in Belleville, will speak on "The Story Behind the Stones: Reading the Monuments". Visitors always welcome. Further details at www.ogs.on.ca/kingston
18 April 2017
Autosomal DNA Database Sizes
A week ago I pointed to a survey being conducted by The DNA Geek. Results from 243 responses are now posted.
The headline result is the effective size of the Family Tree DNA Family Finder database is 14.7% that of AncestryDNA's, 23andMe 13.2% and MyHeritage 0.4%.
Find all the deatils and caveats at http://thednageek.com/estimating-the-sizes-of-the-genealogical-atdna-databases/
Muckanaghederdauhaulia
As long place-names go Ireland's Muckanaghederdauhaulia doesn't rival Llanfairpwllgwyngyllgogerychwyrndrobwllllantysiliogogogoch, the pride of Wales. Irish place-name's don't have to be long to be maddeningly frustrating.
In his latest blog post John Grenham gives tips on online resources to identify those elusive Irish place-names. Find it at www.johngrenham.com/blog/2017/04/17/how-to-identify-irish-places/
Perth & District Historical Society April Meeting
Deborah Ireton, of Drummond/North Elmsley Township, will speak on the work of the Ontario Women’s Institutes – an organisation critical to the history of our province, and now world-wide.
"Deborah Ireton is President of the Lanark South District of the WI and of the Drummond Centre Branch. Her presentation will follow the WI’s significant contribution to Ontario communities from the formation of the first Branch, in Stoney Creek in 1897, through the organisation in 1919 of the Federated Women’s Institutes of Ontario (FWIO). Today the FWIO has 3500 members in 280 branches across the Province – and branches in many countries.
For 120 years, with the motto “For Home and County”, members of the Women’s Institute have actively worked together for family, home, community and country. The objective of the first Women’s Institute Branch, in Stoney Creek, was to improve women’s skills in the art of homemaking and child care. The FWIO was organized in 1919 to provide members with a stronger voice through cooperation. Over time, its original focus expanded to include educational programming and community support, advocacy for social, environmental and economic change, and the personal growth of women.
An important example, the Institute’s ROSE Program (Reaching Ontario Sharing Education), helps increase awareness, and expand the skill sets, of members and others in Ontario communities. Each year thousands of individuals become more knowledgeable on social, health, domestic and environmental matters through participation.
Deborah will bring copies for viewing of the Lanark South District Tweedsmuir Books – which are legendary to historians throughout the Province as a source of local community history.
Deborah grew up in Wemyss, attended school in Christie Lake and Perth, and took Home Economics at Kemptville College of Agricultural Technology. She and husband Jim have lived in Drummond Centre, Ottawa and Kemptville, and are now retired in Drummond Centre. They have two children and two grandchildren. Deborah is a dedicated seamstress, and crafts person in knitting, crocheting and tole paint, and has volunteered at Drummond Central School, and the Canadian Cancer Society. Deborah is also a member of the planning committee for the Provincial Conference of the FWIO, to be held in Pembroke in June this year."
The meeting is at Perth's Royal Canadian Legion, home of the Hall of Remembrance, 26 Beckwith Street E., Perth, at 7:30pm (Toonie donation).
17 April 2017
Genealogy Society Dependence on Membership Fees
At 40 per cent the Ontario Genealogical Society is in the middle of the pack. But it's not steady, over the previous four years varying between 38 and 49 per cent.
The two Prairie province societies show much less dependence on membership fees. That hasn't always been the case. In 2011 the AGS was 39 per cent membership fee dependent.
The Quebec Family History Society is at the other end of the range, 75 per cent membership fee dependent.
If "he who pays the piper calls the tune" what is the message from your society?
FreeBMD April Update
The FreeBMD Database was updated on Sunday| 16 April 2017 to contain 260,984,786 distinct records (260,466,571 at the previous update).
Years with major updates (more than 5,000 entries) are for births: 1963-64, 1976-79; for marriages: 1966, 1977,1979-81; for deaths 1976-80.
Here are the marriage statistics. 1837 has only a half year of data. The FreeBMD dataset is reasonably complete except for 1964-66, 1969 and 1977 and later
The record for marriages was 1941 with 966,941 followed by 1973 and 1948. The years 1916 and 1920 showed an especially large number of marriages.
16 April 2017
Mostly at Sea: Captain Harry Grattidge and his landlocked ancestors
Gail has made available the text and images from that presentation at http://notquiteborninbritain.blogspot.ca. Although the talk was not about the Titanic the word is found 35 times in Gail's text! That's according to Voyant Tools.
At the same site find Gail's previous presentation A Scandal in Battersea, and some other interesting older items
15 April 2017
Findmypast serves up new BC, Norfolk and Sussex records this Easter
British Columbia Estate Files 1859-1949 are now available in browse format at Findmypast. You can narrow results by year, document, court, and one of 15 districts. There is no name index except a probate index for the district of Vancouver, sorted alphabetically by last name. This is most useful if you have death information for another source.
Norfolk Bishop's Transcripts 1687-1901 with over 210,000 records and Norfolk Archdeacon's Transcripts 1600-1812 with more than 76,500 records are browse files for baptisms, marriages and burials. Before searching these check out the Norfolk records at FamilySearch.
For Sussex find an addition to the burials collection, this for the parish of Northiam and the memorial inscriptions for Herstmonceux & Friston.
13 April 2017
OGS Quinte Branch April Meeting
The Quinte Branch of the Ontario Genealogical Society digital presentation is"Taming Your Inner Packrat" by Thomas MacEntee and Lisa Alzo.
Are you drowning in a sea of papers, documents, old photographs and other research materials? Learn how to purge and bust through the clutter, taming your paper and electronic monsters.
Everyone welcome, bring a friend. Quinte West Public Library, 1-3 pm. Visit www.roostweb.ancestry.com/~canqbogs
Ancestry FREE Weekend for British Commonwealth Records
This Easter weekend Ancestry has free access, with registration, to all Commonwealth Records (Australia, Canada, the Caribbean, New Zealand, UK) to April 17.
CEF Service Files Digitization:April Update
The latest digitized is from Box 7260 (7059 last month) and last name Nelles (McLelland). Library and Archives Canada is digitizing the service files systematically, from box 1 to box 10686, which roughly corresponds to alphabetical order.
10,902 (12,585) files were digitized in the last month. At that rate the project would be complete by November 2018. It's unlikely it will be that late as this reporting period is particularly short.
Findmypast adds Scottish Catholic Records
There are 492,616 baptism, 197,926 marriage and 324,670 burial results, plus 268,286 congregational records dating back to 1730 in the latest addition to Findmypast.
They cover the dioceses of St Andrews & Edinburgh, Aberdeen, Argyll & the Isles, Dunkeld, Galloway, Glasgow, Motherwell and Paisley; 115 parishes
The records date back to 1730.
Congregational records include registers of confirmations and communion recipients, as well as parish lists, seat rentals, and lists of people who converted to Catholicism.
Further Scottish records and additional updates from a variety of British, Irish, US and Canadian Dioceses will be added to Findmypast's Roman Catholic Heritage Archive throughout 2017.
More Speaker Handouts from WDYTYA? Live 2017 from the SOG
In addition to those mentioned before, now find the following ten handouts:
Peter Bailey (Saturday 8 April) Baptism, Marriage and Burial Records in British India - Not Available in the "India Office" Records
Peter Christian (Thursday 6 April 2017) Parish Registers Online.
Gill Draper (Saturday 8 April 2017) Going Back In Time. Free Resources for Finding People 13th-19th Centuries
Celia Heritage (Friday 7 April 2017) Surnames and Family History
Sue Mitchell (Thursday 6 April 2017) In Pursuit of Lots! Using Forenames to Build the Family Tree
Sue Mitchell (Saturday 7 April 20170 Do As I Say Not As I Did. Confessions of an Imperfect Genealogist
Robert Parker (Friday 7 April 2017) A Quick Guide to Getting Started
Robert Parker (Top Tips for racing Tour Ancestors 1939-1845
Mike Sharpe (Saturday 8 April 2017) True Brummies. Birmingham Research Before 1837
Erin Tilley (Friday 7 April 2017) How to get Your Kids Interested in Genealogy.
The complete list with links is at www.sog.org.uk/learn/who-do-you-think-you-are-live-2014-speakers-handouts/
FamilySearch adds England, Durham Diocese, Marriage Bonds & Allegations, 1692-1900
Ancestry from Northeast England. If they were in County Durham, the southern part of Tyne and Wear, the boroughs of Darlington, Hartlepool and the area of Stockton-on-Tees north of the River Tees perhaps one of the 93,983 entries in this collection of Marriage Bonds & Allegations will help push your ancestry back further.
The records may contain:
Names of the marriage partnersOnly a few records pre-date the middle of the 18th century.
Ages of the marriage partners
Occupations of the marriage partners
Marital statuses before marriage
Parishes of residence
Parish where the marriage was to take place
Names and signatures of parents, esp. if one of the marriage partners was a minor.
The index entry is linked to an image of the original.
12 April 2017
YouTube: Touring Ottawa 1968-69
BIFHSGO member and photographer Dena Palamedes let me know about a home video taken by her uncle nearly 50 years ago now on YouTube. Thank you Dena.
How much of Ottawa can you recognize?
Free Weekend at FamilyTreeWebinars
Every so often I mention some especially pertinent webinars being offered by Family Tree Webinars. The quality is always high, I'm selective about the topics I recommend.
In celebration of reaching a milestone, congratulations Geoff, beginning on Friday and continuing through Sunday evening, the entire library - all 500 classes - will be open and free to the public.
Visit www.FamilyTreeWebinars.com and browse or search for any topic or presenter and enjoy!
You may also enjoy Geoff's reflections on his webinar journey.
11 April 2017
Terrence Michael Peter Punch R.I.P.
Read about him in this appreciation by Brenda Dougall Merriman and a summary of his career to 2013 on being awarded a Doctor of Letters (Honoris Causa) from Saint Mary's University.
Speaker Handouts from WDYTYA? Live 2017 from the SOG
The following handouts from Who Do You Think You Are? Live @Birmingham NEC 6-9 April 2017 are now available at www.sog.org.uk/learn/who-do-you-think-you-are-live-2014-speakers-handouts/
Paul Carter (Saturday 8 April 2017) Six Tips for Publishing Your Research on the Web
Else Churchill (Thursday 6 April 2017 & Saturday 8 April 2017) The Society of Genealogists On and Off Line
Else Churchill (Thursday 6 April 2017) Country Bumpkins.Tracing Rural Ancestors
Else Churchill (Friday 7 April 2017) I'm Stuck. Some Ideas for Solving Genealogical Problems
Else Churchill (Saturday 8 April 2017) Tracing Women Ancestors
Brian Donavan (Saturday 8 April 2017) The Digital Revolution in Irish Genealogy
Janet Few (Thursday 6 April 2017) Engaging Young Children in Family History
Janet Few (Friday 7 April 2017) The Ones That Got Away.Tracng Elusive Ancestors
Doreen Hopwood (Thursday 6 April 2017) Where Did They Come From and Why?
Dr Jane Howells (Thursday 6 April 2017) Townies. Ancwstors in Small Market Towns
Michelle Patient (Thursday 6 April 2017) Creating a Family History Website
Graham Walter (Friday 7 April 2017 & Saturday 8 April 2017) Five Killer Aps for Family Historians
More will likely be added.
Ancestry adds Bedfordshire, England, Electoral Registers, 1832-1986
17,982,277 entries appear in this set of electoral registers from the Bedfordshire Archives and Records Service newly added to Ancestry. It allows you to follow the residence of those qualified to vote from year to year.
The index was created from the printed registers using text recognition software, not transcribed, so expect lots of anomalies.
10 April 2017
Help Estimate Autosomal Database Sizes
If you've taken an autosomal DNA test from more than one company please considered completing a short survey.
While AncestryDNA and 23andMe release updates on the size of their databases Family Tree DNA and MyHeritage have yet to do so. Size matters if you're looking to make genetic matches. \\
By crowdsourcing information from people who have tested at more than one company The DNA Geek aims to assess the relative sizes of the databases and, for 23andMe, determine how many are participating in relative matching.
Find the survey by following the link http://thednageek.com/lets-track-the-autosomal-database-sizes/
Genetic Genealogy presentations from WDYTYA? Live 2017
Each year Maurice Gleeson posts YouTube videos of some of the presentations made in the Family Tree DNA sponsored DNA Workshop at WDYTYA? Live in Birmingham.
Now the event is over Maurice is taking a week off before beginning posting the videos. See what you might have to look forward to in the post by Debbie Kennett, a schedule of presentations made in Birmingham. Those in the SOG Theatre 2 are not normally posted.
In the meantime Debbie has made available as a pdf the slides from her presentation Autosomal DNA demystified.
You can also view presentations on YouTube from previous events, the most recent being at Genetic Genealogy Ireland 2016 last October.
Photos from the BIFHSGO April Meeting
Find a slideshow of candid photos of the meeting at https://youtu.be/-n48mt_s2Kw
British Newspaper Archive passes 19 million page milestone
As of Sunday the British Newspaper Archive had 19,025,286 pages passing the 19 million page milestone. That's on the way to 40 million pages.
If you haven't searched for your British ancestors you haven't done a reasonably exhaustive search, and even if you did a while ago new pages are added almost every day.
09 April 2017
08 April 2017
Ancestry: Centennial Anniversary of WWI Battle of Vimy Ridge
New Irish Genealogy Records 2011-2016
Claire's Irish Genealogy News is one of the few on my "daily visit" bookmark list.
Findmypast adds Wiltshire BBMB Transcripts
Wiltshire Parish Baptisms Index 1538-1917: 2,286,650 results
Wiltshire Parish Banns Index 1538-1933: 126,706 results
Wiltshire Parish Marriages Index 1538-1933; results
Wiltshire Parish Burials Index 1538-1991: 1,453,000 results.
The search can be performed at parish or whole county levels.
There are no images, except for the marriages taken from Phillimore's where those old transcript images are linked. Those Phillimore volumes are on the Internet Archives and the basis of most Wiltshire parish records on TheGenealogist.
Word from Dick Eastman is that similar parish records for Berkshire, Buckinghamshire, Nottinghamshire, Somerset and Warwickshire will follow in the next six months.
Were your family members "stay at home" or "adventurer"?
A study reported here for Britain shows that while "the previous generation lived just five miles from where they were born on average, compared with 100 miles now."
Does that apply in your family?
I live 3,300 miles from my birthplace, 10 miles away until migrating. When I was born my parents lived 260 mi and 350 miles from their birthplaces, grandparents 3, 105, 140, and 145 miles. -- all within Great Britain.
What's the situation for your ancestors?
07 April 2017
Maps
On a broader scale, the Historical Topographic Map Digitization project digitizing and georeferencing early-to-mid 20th century historical topographic maps covering the province of Ontario at the scales of 1:25,000 and 1:63,360.
via tweets from David Reevely and Jane MacNamara.
YouTube: 8 Reasons You Should Consider Joining a Local Genealogical Society
A short video from the Jewish Genealogical Society of Long Island. Eight reasons, can you think of others?
Ancestry adds London, England, Metropolitan Police Pension Registers, 1852-1932
Ancestry's new database of Metropolitan Police Pension Registers MEPO 21 from The National Archives of the UK, is a collection full of detail for London policemen.
These are registers of pensions awarded to Metropolitan Police officers who retired or resigned from the force between 1852 and 1932, and who were granted, or who (after 1890) qualified for, a police pension.
There's a wealth of personal information, place of birth, marital status, parents and next of kin, service details, and from 1923, details of spouse (date of birth and place of their marriage). Much of the information is on a second page so scroll to the right to see that.
06 April 2017
WDYTYA? Live Happenings: TheGenealogist
From England:
Hampshire Parish Records (Bishop's Transcripts)
With the addition of over 886,000 individuals, this brings the total number of records to over 3.1 Million with coverage of:
Baptisms: 1538-1940 (2,379,836 individuals)
Marriages: 1538-1940 (495,034 individuals)
Burials: 1538-1940 (324,950 individuals).
Durham Parish Records
With the addition of nearly 1.7 million individuals, this brings the total number of records to over 1.8 Million with coverage of:
Baptisms: 1556-1919 (1,253,273 individuals)
Marriages: 1540-1896 (198,845 individuals)
Burials: 1538-1939 (397,950 individuals).
The British in India Collection, includes
A broad-ranging set of resources ranging from the early 1800s up to the 1920s.
Parish Records of British in India
Headstone Records of British Cemeteries in India
British War Memorials in India
East India Registers
Indian Army and Civil Service Lists
Image Archive - British in India
Read more at www.thegenealogist.co.uk/featuredarticles/2017/the-british-in-india-collection-481/
I notice that Celia Heritage, theme speaker at next fall's BIFHSGO conference, is again this year speaking in TheGenealogist theatre at the show.
Why Are Your DNA Ethnicity Results Unexpected: Analysis
Just before Christmas I received an email from Living DNA to tell me my results would be delayed. The first sample had returned too many no call results.
When the results did arrive it was in advance of the original date promised. Good job Living DNA.
It made me wonder, how many no calls is too many? Do all the SNPs used in the analysis have to be called, or is there some flexibility? How many is enough? How much will the analysis be impacted if some are missing?
Some insight comes from the two sets of results, analysis of the same person by 23andMe at different times.
European
| 98.2% | 98.3% |
|---|---|---|
| British & Irish | 55.7% | 56.7% |
| French & German | 3.1% | 3.5% |
| Scandinavian | 0.1% | 0.1% |
| Broadly Northwestern European | 13.0% | 12.0% |
| Ashkenazi Jewish | 18.8% | 18.8% |
| Iberian | 0.0% | 0.9% |
| Italian | 0.4% | 0.4% |
| Broadly Southern European | 4.5% | 3.7% |
| Broadly European | 2.3% | 2.0% |
Another analysis factor is the reference databases used by the various companies. While there are some databases openly available the companies add data from other research including their clients results. The recent changes in Family Tree DNA's myOrigins assignments, which were introduced with minimal explanation - "smaller trace-percentage results" - "newly refined European, Middle Eastern and Native American clusters," illustrate the impact.
If you tested with more than one company adding to the confusion is the the different ways the companies segment and characterise regions. Reminiscent of the saying that a person with a watch knows the time, someone with two is never sure.
This is the final post in the Why Are Your DNA Ethnicity Results Unexpected series. If you missed the others, or want to read them again, they are:
Misattributed Parentage
Brick Walls
Recombination
BIFHSGO April Meeting
9:00 am to 9:30 am
Canadians on Vimy Ridge, 1917: A Short Guide to Resources and Research (Before BIFHSGO Education Talk), by Glenn Wright
Did you have an ancestor in the Canadian Expeditionary Force who participated in the battle for Vimy Ridge in April 1917? Just a few days before the 100th anniversary Glenn Wright's presentation will highlight the major sources of information: service documents, war diaries, unit records, useful websites, and published resources.
Glenn Wright is past-president of BIFHSGO and author of Canadians at War, 1914-1919: A Research Guide to World War One Service Records.
10:00 am to 11:30 am
Mostly at Sea: Captain Harry Grattidge (Monthly Meeting)
Gail Roger’s mild obsession with the Titanic led her to the discovery of the closest thing to a celebrity in her family tree: Harry Grattidge — sailor, survivor, and a Commodore of the Cunard Line. No, she hadn’t heard of him either. We will meet some of the Grattidge ancestors that Harry and Gail have in common, ponder the blessings and drawbacks of a highly unusual surname, and discover how Harry came to be a consultant on a classic film by surviving Britain’s worst maritime disaster (not the Titanic).
Gail Roger has been a BIFHSGO member for over a dozen years, and it took her the first seven years to pluck up the courage to make her first BIFHSGO presentation. This is her fifth. Gail’s family will tell you that her obsession with the Titanic is not as mild as she claims. They are mistaken. They also say that her obsession with family history borders on the frightening. They may have a point.
That's not all. At the Discovery Tables
Four Soldiers of Vimy Ridge and Glass Plate Photographs
In June 2016, Brian Glenn gave us a Great Moments talk on the Stories Behind Glass Plate Photographs of The Great War. This month, he will bring in the glass plate photographs the talk was based on for us to view.
Irish Research Success
Anne Renwick has been helping a friend do some research of her Irish roots. While doing this detective work, she has so far gleaned some interesting artifacts and pictures which she is going to share with us. We will learn about Anne's success in an area where research is often difficult.
Global Genealogy
Rick and Sandy Roberts from Global Genealogy will bring some of their genealogy books and products to sell.
And more,
Pick up some surplus journals and magazine at the table run by Brian Chamberlain and express your appreciation by making a donation toward operation of the library.
Visit the Friends of the Ottawa Public Library Bookstore.
Stop by the OPL Branch after the meeting.
UPDATE: Want another presentation on Saturday. Head over to Stittsville for a 1:30 pm DNA presentation by Jason Porteous - http://stittsvillecentral.ca/events/dna-for-genealogy-with-jason-porteous/
05 April 2017
Ireland: Tracing Heritage & Traditions with AncestryProGenealogists
A note came in from Kyle Betit, one of the leaders of a tour of Ireland in October 2017. The tour is a partnership between AncestryProGenealogists and Go Ahead Tours.
The tour of the southern half of the island will include Dublin, Kilkenny, County Wexford, County Cork, Cork City, Cobh, Killarney, Ring of Kerry, County Clare, Cliffs of Moher, Galway City, Connemara, and Clonmacnoise.
There's detailed information at the tour website: https://ancestry.grouptoursite.com/
Kyle, who was theme speaker at BIFHSGO Conference 2016, is a presenter at the Alberta Genealogical Society Conference 2017 later this month.
Ancestry adds Dorset, England, Poor Law Settlement and Removal Records, 1682-1862
The communities included, you don't need to know that for the neame search, are: Beaminster, Bere Regis, Blandford Forum, Bradford Abbas with Clifton Maybank, Broadwindsor, Buckland Newton, Burton Bradstock, Canford Magna, Castleton, Cerne Abbas, Corfe Castle, Corscombe, Cranborne, East Stour, Folke, Fontmell Magna, Fordington - St George, Frampton, Glanvilles Wootton, Hammoon, Hampreston, Hermitage, Hilton, Holnest,, Holwell, Kington Magna, Langton Herring, Litton Cheney, Long Crichel, Longburton, Lydlinch, Lyme Regis, Maiden Newton, Melbury Bubb, Melbury Osmond with Melbury Sampford, Milton, Abbas, Minterne Magna, Mosterton, Motcombe, Nether Compton, Netherbury with Salway Ash, North Poorton, Pimperne, Poole, Powerstock, Puddletown, Rampisham, Sandford Orcas, Seaborough, Sherborne, Shipton Gorge, Sixpenny Handley, South Perrott, Stoke Abbott, Stour Provost, Sturminster Marshall, Sydling, St Nicholas, Symondsbury, Tarrant Monkton with Tarrant Launceston and, Wareham
04 April 2017
Family Tree DNA update Ethnic Origins
If you've taken the Family Tree DNA Family Finder test check the revised ethnic origin assessments just posted. Mine have changed but not dramatically.
European from 76 to 73 per cent, comprising:
British Isles from 71 to 66 per cent
East Europe from 5 to 7 per cent
Jewish Diaspora (Ashkenazi) from 19 to 23 percent. Sephardic is now explicitly mentioned, Other companies incorporate the Jewish with the European total.
There are also three areas which I'm analysed to have less than 2 per cent, but with a note that "A trace percentage indicates a very small amount of shared DNA in common with the corresponding population. In some cases this minor percentage could be attributed to background noise."
Did you your resultd show any significant change?
UPDATE: An update on the new version was posted on 7 April at https://www.familytreedna.com/learn/autosomal-ancestry/myorigins-2-0-update/. Sadly it gives nothing by way of detail.
LAC in 2030 -- NOT
Why Are Your DNA Ethnicity Results Unexpected: Recombination
During meiosis half of each parent's DNA is lost to the following generation through the process of recombination. Some ancestral ethnicities may well be completely absent if they are a minor component of the parent's DNA. If an ethnicity constitutes more than half of either parent's DNA it will still occur in the child's, even in the most extreme case.
| Sib 1 | Sib 2 | Sib 3 | |
|---|---|---|---|
| European | 98.2 | 98.5 | 98.1 |
| British & Irish | 55.7 | 45.1 | 42.7 |
| French & German | 3.1 | 2.4 | 8.8 |
| Scandinavian | 0.1 | 1.7 | 1.1 |
| Broadly NW Europe | 13.3 | 24.0 | 15.0 |
| Ashkenazi | 18.8 | 18.2 | 23.4 |
| Iberian | 0.0 | 0.5 | 0.4 |
| Italian | 0.4 | 0.6 | 0.9 |
| Broadly S Europe | 4.5 | 2.3 | 2.5 |
| Broadly Europe | 2.3 | 3.7 | 3.3 |
| Other | 1.8 | 1.5 | 1.9 |
For some insight into how this works use the analogy to a deck of cards. Your parent deals out 26 cards to you from their DNA deck of 52.
If all the cards except aces represent European ancestry the parent has 92.3 percent European ancestry. The 26 cards dealt could contain 0, 1, 2, 3 or 4 aces. Zero aces, means ((26-0)/26) = 100 percent European. 4 aces means ((26-4)/26) = 84.6 percent European. It can't go lower. You could have a greater percentage than your parent.
If the red cards represent British and Irish (B&I) ancestry, and the black any other, the parent has 50 percent B&I ancestry. Dealing out 26 cards it's possible they could all be red (100 percent B&I) or all black, but neither is likely. Using the Hypergeometric Calculator most (90 percent) of the time the percent B&I will be between 35 and 62 percent.
If one suit, say hearts, represents Ashkenazi ancestry out of a deal of 26 cards a maximum of 13 and minimum of zero could be hearts (Ashkenazi). The Hypergeometric Calculator shows that most (90 percent) of the time the percent Ashkenazi will be between 11 and 35 percent. In case you're wondering, the three values for Ashkenazi in the table are well within range for the expected value of 20 percent.
Finally, take the case of one card out of 52 which represents a trace ethnic ancestry. In the deal of 26 cards half of the time that card is absent, zero percent, the other half it's present. That's 3.8 percent, a larger percentage than the parent.
While the analogy with cards is helpful it can be pushed too far. We may or may not inherit an entire parental ethnic segment -- it's as if we could tear the cards in pieces.
Looking further back, at the 10th generation only about half your genealogical ancestors are genetic ancestors, see https://gcbias.org/2013/11/04/how-much-of-your-genome-do-you-inherit-from-a-particular-ancestor/. Cousin marriages amplify the contribution from their ancestry.
If you want to go back even further, contemplate this blog post from John Grenham.
Book Review: The War of 1812 in British North America
When author Kenneth G. Cox found himself lamenting the lack of a comprehensive inventory of Canadians who served during the War of 1812, not so for US and British regular forces, he set out to do something about it.
The result is this self-published book which is, in Cox's words, "an attempt to compile some of the records which do exist, although by no means exhaustive." Relevant documents continue to be uncovered.
To get you started on the right foot the first Chapter "Beginning Your Research" gives a little background on the war, an overview of resources from the main repositories, plus a ten-step guide to research.
The following chapters, many of which include appendices with lists of names or contents of archival microfilm, delve into the various sources.
Your Ancestor's Army: Muster Rolls and Pay listsThe book does not venture far into the history of the war. Several resources developed during the bicentenary are available online.
Your Ancestor's Navy: Ships' Musters and Seamen's Wills
The Records of the Loyal and Patriotic Society
Prince Regent's Bounty and Land Grants to Veterans
The War Losses Claims Commission
The 1875 Bounty paid to surviving veterans of The War of 1812
The Records of the Military and Naval General Service Medals
The Records of the Chelsea Pensioners, Royal Hibernian Military School and Greenwich Hospital
Searching for First Nation Warriors
American Records: Soldiers, Traitors, Prisoners of War, Colonial Marines and Black Refugees
Transcribed records, Rare books, Manuscripts and Documents.
Sadly there is no index. I looked for mention of De Watteville's Regiment and had to scan every page. You will likely notice font changes between chapters and some
formatting problems
which are annoyances without distracting from the content.
While I don't have ancestors or known relatives who served during the war, if I did I'd be continuing to refer to Cox's book to ensure a reasonably exhaustive search.
My review copy was provided by Global Genealogy, not the publisher but responsible for printing and distributing the book. Find it for sale at http://globalgenealogy.com/countries/canada/military/resources/301405.htm
03 April 2017
Toronto Lecture: General Wolfe Letters
Those in the Toronto area may be interested in the 23rd annual George Kiddell Memorial Lecture being presented this Wednesday.
Who's Afraid of General Wolfe? Adventures in Archives and Authorship
Kathleen Winter, author of Boundless: Tracing Land and Dream in a New Northwest Passage, will discuss her use of General James Wolfe's letters held at the Thomas Fisher Rare Book Library in crafting her latest work. Anne Dondertman, retired Associate Chief Librarian for Special Collections, will tell the fascinating story of how these remarkable papers were acquired.
When: 2:00-3:00, Wednesday, April 5
Where: Thomas Fisher Rare Book Library, 120 St. George St, Toronto, ON
RSVP: events.library@utoronto.ca or 416-978-3600
LAC's DigiLab Opens
I had the opportunity to trial the facility last week using the Book2net public scanner III (link is to a similar machine.) The learning curve is gentle, place the item to scan, press a button and the machine focuses, aligns and crops automatically. It even adjusts for moderate curvature on bound or bent originals. You see the scanned image on the screen to check for image quality. I choose to scan to a multi-image pdf. You log a basic description of each file on a nearby computer.
I was scanning original records of weather observations, three times a day, taken in Ottawa in the 1870s and 80s. Each sheet contained a week's observations. The image above is a just a small part of the sheet, observations for 3 April 1874.
There are several other smaller machines which I didn't try, I think they are model ScanSnap SV600
All of the material digitized through the DigiLab will be made available online for general public access. You get to walk away at the end of the session with a USB drive (bring your own) with all your images.
Judging by the number of people who photograph documents while researching at LAC, and the superior quality of the images from DigiLab equipment, it seems likely it will prove popular over time.
Melanie Brown, manager of the facility will be making a presentation to OGS Ottawa Branch later this month.
Why Are Your DNA Ethnicity Results Unexpected: Brick Walls
Living DNA states their sub-regional results refer to “founder populations,” about 10 generations back. Yet for most people that's beyond the genealogical horizon. So how can you judge the reality of your ethnicity results from a DNA test?
Typically people assume the earliest generation they know about along any line is representative of their ancestors.
In my case with parents born in Scotland and Wales, one grandparent born in Wales, the rest in England, it's not a very good assumption at that recent period, unless you look at a larger scale -- Great Britain.
Were people in earlier times less mobile? Perhaps, but the generations you don't know about are the ones more likely to have moved. That's likely why you can't find them.
Another approach is to use surname distributions. If you have an ancestor with an uncommon surname and no obvious ancestry in the area, they may well have come from the area where the name is most common.
Just because you don't find the area found by an ethnic ancestry test in your paper record based family tree doesn't mean the results are not reality.
02 April 2017
April Backup Nag
This past month I've had problems with one of my laptops. I was thankful the important data was backed up.
Have you done your start of the month backup yet?
Archives Appreciation Week?
3-7 April is Archives Awareness Week in Ontario. What's happening?
The Archives of Ontario have a program including a series of presentations exploring new pathways and initiatives in the delivery and preservation of historical materials in Ontario. It's on Thursday, 6 April from 1:30-4:00 p.m. and organized by the Ontario Historical Society.
Grey Roots is offering free admission to the Reading Room for researchers (although donations gratefully received - thank you for your support). A behind-the-scenes tour will leave the Reading Room at 2:30 p.m. on Wednesday, 5 April.
The Hamilton Public Library has a week of activities starting with a talk A Lemon in the Lemon Tree by OGS Director-at-Large Mike Quackenbush on 3 April.
The Bruce County Museum & Cultural Centre is offering free admission to the Archives and Research Room from April 3rd to 8th with guided tours and special presentations on 2 April. That will include an introduction to DNA testing for genealogy researchers, and an update on the Bruce County Historical Society’s Documentary Project.
Celebrations at Ottawa area archives are low-key as they work on Canada 150 projects. The City Archives issued a press release inviting visitors.
If you benefit from an archives why not turn awareness into appreciation and let them know that you value the services offered.
01 April 2017
Blaine Bettinger Webinar on AncestryDNA Genetic Communities
Blaine makes the point that the facility is under continuous development. As if to prove it an Asia region has been added since his talk.
Blaine is a featured speaker at the OGS Conference this June in Ottawa.
New this week from Findmypast
Northamptonshire Militia Lists 1771, provides transcripts of 13,468 men, age 18-45 in the original militia lists held by the Northamptonshire Record Office. Find name, occupation and place. Occupations includes servant (2,336) and labourer (2,151).
Northamptonshire Freeholders 1795-1797, is a transcript collection of name, date, occupation and place for 4,103 freeholders. Occupations of this rural county include farmers (519), yeoman (195), grazier (155), esquire (100), gentleman (97), butcher (62), baker (45), blacksmith (18), maltster (18), weaver (14).
Collection additions this week are:
Dorset Memorial Inscriptions, the addition of 20,267 records of gravestones, tombs and monuments. The total is now 106,135 records.Half the records are for the 20th century.
Scotland Registers & Records, 10,488 records added for a total of 25,598 facilitating exploring life in the area, especially Renfrewshire in the additions.











